The Grand Locus / Life for statistical sciences


the Blog

A tutorial on Burrows-Wheeler indexing methods (3)

This post is part of a series of tutorials on indexing methods based on the Burrows-Wheeler transform. The first part describes the theoretical background, the second part shows a naive C implementation, and this part shows a more advanced implementation with compression.

The code is written in a very naive style, so you should not use it as a reference for good C code. Once again, the purpose is to highlight the mechanisms of the algorithm, disregarding all other considerations. That said, the code runs so it may be used as a skeleton for your own projects.

The code is available for download as a Github gist. As in the second part, I recommend playing with the variables, and debugging it with gdb to see what happens step by step.

Constructing the suffix array

First you should get familiar with the first two parts of the tutorial in order to follow the logic of the code below. The file learn_bwt_indexing_compression.c does the same thing as in the second part. The input, the output and the logical flow are the same, but the file is different in many details.

We start with the definition of the occ_t...

A tutorial on Burrows-Wheeler indexing methods (2)

This post is part of a series of tutorials on indexing methods based on the Burrows-Wheeler transform. The first part describes the theoretical background, this part shows a naive C implementation of the example followed through in the first part and the third part shows a more advanced implementation with compression.

It makes little sense to implement a Burrows-Wheeler index in a high level language such as Python or JavaScript because we need tight control of the basic data structures. This is why I chose C. The purpose of this post is not to show how Burrows-Wheeler indexes should be implemented, but to help the reader understand how it works in practice. I tried to make the code as clear as possible, without regard for optimization. It is only a plain, vanilla, implementation.

The code runs, but I doubt that it can be used for anything else than demonstrations. First, it is very naive and hard to scale up. Second, it does not use any compression nor down-sampling, which are the mainsprings of Burrows-Wheeler indexes.

The code is available for download as a Github gist. It is interesting for beginners to play with...

A tutorial on Burrows-Wheeler indexing methods (1)

This post is part of a series of tutorials on indexing methods based on the Burrows-Wheeler transform. This part describes the theoretical background, the second part shows a naive C implementation of the example below, and the third part shows a more advanced implementation with compression.

There are many resources explaining how the Burrows-Wheeler transform works, but so far I have not found anything explaining what makes it so awesome for indexing and why it is so widely used for short read mapping. I figured I would write such a tutorial for those who are not afraid of the detail.

The problem

Say we have a sequencing run with over 100 million reads. After processing, the reads are between 20 and 25 nucleotide long. We would like to know if these sequences are in the human genome, and if so where.

The first idea would be to use grep to find out. On my computer, looking for a 20-mer such as ACGTGTGACGTGATCTGAGC takes about 10 seconds. Nice, but querying 100 million sequences would take more than 30 years. Not using any search index, grep needs to scan the whole human genome, and this takes time...

the Blog
Best of

the Lab
The team
Research lines
Work with us

Blog roll
Simply Stats
Bits of DNA